|
Gene Codes Inc
computer program sequencher version 4 2 for windows Computer Program Sequencher Version 4 2 For Windows, supplied by Gene Codes Inc, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/simple+sequence+repeat+identification+tool/sequencher+%EC%97%BC%EA%B8%B0%EC%84%9C%EC%97%B4%EC%9D%80/10__1051_slash_kmae_ascii58_2005018-67-17-24 Average 86 stars, based on 1 article reviews
computer program sequencher version 4 2 for windows - by Bioz Stars,
2026-09
86/100 stars
|
Buy from Supplier |
|
PrimerDesign Inc
microsatellite-containing sequences Microsatellite Containing Sequences, supplied by PrimerDesign Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/simple+sequence+repeat+identification+tool/microsatellite+containing+sequences/pm22539519-43-24-34 Average 90 stars, based on 1 article reviews
microsatellite-containing sequences - by Bioz Stars,
2026-09
90/100 stars
|
Buy from Supplier |
|
Bio-Rad
algorithms imagej nih ![]() Algorithms Imagej Nih, supplied by Bio-Rad, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/simple+sequence+repeat+identification+tool/Image+Lab+Software/pmc08172529-1137-258-268 Average 99 stars, based on 1 article reviews
algorithms imagej nih - by Bioz Stars,
2026-09
99/100 stars
|
Buy from Supplier |
|
FLUXUS ENGINEERING LIMITED
network 4.613 software ![]() Network 4.613 Software, supplied by FLUXUS ENGINEERING LIMITED, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/simple+sequence+repeat+identification+tool/network+4+6+software/pm27784894-58-29-34 Average 90 stars, based on 1 article reviews
network 4.613 software - by Bioz Stars,
2026-09
90/100 stars
|
Buy from Supplier |
|
Glencoe Software Inc
omero ![]() Omero, supplied by Glencoe Software Inc, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/simple+sequence+repeat+identification+tool/OMERO/bio_rxiv__2020__07__17__208744-118-9-10 Average 95 stars, based on 1 article reviews
omero - by Bioz Stars,
2026-09
95/100 stars
|
Buy from Supplier |
|
Unigene
microsatellite identification tool misa ![]() Microsatellite Identification Tool Misa, supplied by Unigene, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/simple+sequence+repeat+identification+tool/identification+microsatellite+misa+tool/pm41901379-211-11-7 Average 86 stars, based on 1 article reviews
microsatellite identification tool misa - by Bioz Stars,
2026-09
86/100 stars
|
Buy from Supplier |
|
Cargill Inc
microsatellite mapping sets ![]() Microsatellite Mapping Sets, supplied by Cargill Inc, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/simple+sequence+repeat+identification+tool/mapping+microsatellite+sets/pm17406025-15-6-27 Average 86 stars, based on 1 article reviews
microsatellite mapping sets - by Bioz Stars,
2026-09
86/100 stars
|
Buy from Supplier |
|
PopulationGenetics
excel microsatellite toolkit 3.1.1 ![]() Excel Microsatellite Toolkit 3.1.1, supplied by PopulationGenetics, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/simple+sequence+repeat+identification+tool/excel+microsatellite+toolkit+3+1+1/10__23880_slash_bpoj___16000137-82-29-26 Average 90 stars, based on 1 article reviews
excel microsatellite toolkit 3.1.1 - by Bioz Stars,
2026-09
90/100 stars
|
Buy from Supplier |
|
PrimerDesign Inc
perl script microsatellite identification tool ![]() Perl Script Microsatellite Identification Tool, supplied by PrimerDesign Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/simple+sequence+repeat+identification+tool/perl+script+microsatellite+identification+tool/pm36661497-67-7-4 Average 90 stars, based on 1 article reviews
perl script microsatellite identification tool - by Bioz Stars,
2026-09
90/100 stars
|
Buy from Supplier |
|
SourceForge net
gmato ![]() Gmato, supplied by SourceForge net, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/simple+sequence+repeat+identification+tool/gmato/pmc05397612-91-2-7 Average 90 stars, based on 1 article reviews
gmato - by Bioz Stars,
2026-09
90/100 stars
|
Buy from Supplier |
|
PrimerDesign Inc
microsatellite primer discovery tool ![]() Microsatellite Primer Discovery Tool, supplied by PrimerDesign Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/simple+sequence+repeat+identification+tool/microsatellite+primers/pm16429310-41-15-0 Average 90 stars, based on 1 article reviews
microsatellite primer discovery tool - by Bioz Stars,
2026-09
90/100 stars
|
Buy from Supplier |
|
Protein Simple Inc
sw version 6 1 0 protein simple compass software ![]() Sw Version 6 1 0 Protein Simple Compass Software, supplied by Protein Simple Inc, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/simple+sequence+repeat+identification+tool/Simple-Western-System/pm40639372-221-18-21 Average 99 stars, based on 1 article reviews
sw version 6 1 0 protein simple compass software - by Bioz Stars,
2026-09
99/100 stars
|
Buy from Supplier |
Image Search Results
Journal: Cell metabolism
Article Title: A methionine-Mettl3- N 6 -methyladenosine axis promotes polycystic kidney disease
doi: 10.1016/j.cmet.2021.03.024
Figure Lengend Snippet: KEY RESOURCES TABLE
Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Anti-METTL3 Abcam ab195352 Anti-METTL3 Invitrogen MA5-27527 Anti-m 6 A Abcam ab151230 Anti-c-Myc Abcam ab185656 Anti-c-Myc Sigma OP10-200UG Anti-Avpr2 EMD AB1797P Anti-Puromycin Developmental Studies Hybridoma Bank PMY-2A4 Anti-HA Cell Signaling #3724 Anti-PCNA Santa Cruz sc-7907 Anti-pHH3 Sigma H0412 Anti-pCreb1 Cell Signaling 9198S Anti-Yap Cell Signaling #4912 Anti-GFP Aves GFP-1020 Anti-DBA Vector Laboratories B-1035 Anti-Mettl14 Sigma HPA038002 Bacterial and Virus Strains Ad-CMV-iCre virus Vector Biolabs #1045 Biological Samples Normal human and ADPKD kidney samples PKD Biomarkers and Biomaterials Core in the Kansas PKD Center at the Kansas University Medical Center (KUMC) Chemicals, Peptides, and Recombinant Proteins Puromycin Invitrogen A1113803 O-Propargyl-Puromycin JenaBioScience NU-931-5 8-Br-cAMP Sigma B7880 alamarBlue Invitrogen DAL1025 methionine Sigma M5308 s-adenosylmethionine Cayman Chemicals 13956 s-adenosylhomocysteine Cayman Chemicals 13603 Critical Commercial Assays m 6 A elisa kit Epigentek P-9005-96 SAM elisa kit Cell Biolabs STA-671-C Magna MeRIPTM m 6 A Kit EMD Millipore 17-10499 Submitted data MeRIP-seq NCBI Gene Expression Omnibus GSE165956 RNA-seq NCBI Gene Expression Omnibus GSE165956 Experimental Models: Organisms/Strains Ksp/Cre Shibazaki et al., 2008 N/A Ksp/rtTA Pan et al., 2013 N/A tetO-Cre Jackson Laboratories Stock No: 006234 Pkd1 F/F Jackson Laboratories Stock No: 010671 Pkd1 RC/RC ( PKD1 p.R3277C) Hopp et al., 2012 N/A Mettl3 F/F UT Southwestern Med Ctr N/A Mettl3 Tg UT Southwestern Med Ctr N/A mIMCD3 cells ATCC CRL 2123 Oligonucleotides siRNA against Mettl3 (UGGUUUACAUGUCGACUAA, UGGUUUACAUGUUGUGUGA, UGGUUUACAUGUUUUCUGA, UGGUUUACAUGUUUUCCUA) Dharmacon L-049446-01-0020 Scrambled siRNAs (ACAGCAGGCACAGACAGGCAGU) Dharmacon D-001810-10-20 Recombinant DNA Plasmid - CAG-LSL-Mettl3cDNA-HA/HA/HA-IRES-GFP This paper N/A Plasmid - pLightSwitch Empty (pLS) 3′-UTR Switchgear Genomics S890005 Plasmid - pGL3 Promega E1751 Software and
Techniques: Plasmid Preparation, Virus, Recombinant, Enzyme-linked Immunosorbent Assay, Gene Expression, Software